Stem-loop sequence chi-mir-151

AccessionMI0030639 (change log)
DescriptionCapra hircus miR-151 stem-loop
Gene family MIPF0000057; mir-28
Literature search

1 open access papers mention chi-mir-151
(1 sentences)

Stem-loop
   ---------ac  uu      c            ca          c ucu 
5'            ac  uuccug ccucgaggagcu  cagucuagua g   c
              ||  |||||| ||||||||||||  |||||||||| |    
3'            ug  agggac ggaguuccucga  gucagaucau c   a
   uccacucauac  cu      a            -a          c ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr14: 13263949-13264042 [+]
intergenic
Database links

Mature sequence chi-miR-151-5p

Accession MIMAT0035981
Sequence

16 - 

ucgaggagcucacagucuagu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-151-3p

Accession MIMAT0035982
Sequence

52 - 

cuagacugaagcuccuugagg

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).