Stem-loop sequence chi-mir-148b

AccessionMI0030637 (change log)
DescriptionCapra hircus miR-148b stem-loop
Gene family MIPF0000056; mir-148
Literature search

4 open access papers mention chi-mir-148b
(8 sentences)

Stem-loop
   aucauuuccagucacc uu   a       ug         u  a    ca    gugg u 
5'                 g  agc uuugagg  aaguucugu au cacu  ggcu    c c
                   |  ||| |||||||  ||||||||| || ||||  ||||    | u
3'                 c  ucg aagcucu  uucaagaca ua guga  cuga    g c
   ------------cgau uu   a       gu         c  c    --    --aa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr5: 26340976-26341084 [-]
intergenic
Database links

Mature sequence chi-miR-148b-5p

Accession MIMAT0035978
Sequence

32 - 

gaaguucuguuauacacucaggc

 - 54

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-148b-3p

Accession MIMAT0035979
Sequence

71 - 

ucagugcaucacagaacuuugu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).