Stem-loop sequence chi-mir-148a

AccessionMI0030636 (change log)
DescriptionCapra hircus miR-148a stem-loop
Gene family MIPF0000056; mir-148
Literature search

6 open access papers mention chi-mir-148a
(21 sentences)

Stem-loop
   caguuuggucuuuu              -  -a    cc    -   aa 
5'               gaggcaaaguucug ag  cacu  gacu cug  u
                 |||||||||||||| ||  ||||  |||| |||  a
3'               cucuguuucaagac uc  guga  cuga gau  u
   -----------gau              a  ac    --    a   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 71633508-71633592 [+]
intergenic
Database links

Mature sequence chi-miR-148a-5p

Accession MIMAT0035976
Sequence

20 - 

aaaguucugagacacuccgacu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-148a-3p

Accession MIMAT0035977
Sequence

58 - 

ucagugcacuacagaacuuugu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).