Stem-loop sequence chi-mir-146b

AccessionMI0030634 (change log)
DescriptionCapra hircus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

4 open access papers mention chi-mir-146b
(6 sentences)

Stem-loop
   uaa  gaacuu    -  -  u   u  g        a    a    cu  ga  u 
5'    ga      uggc ca cc ggc cu agaacuga uucc uagg  gu  gc c
      ||      |||| || || ||| || |||||||| |||| ||||  ||  ||  
3'    cu      aucg gu gg ccg gg ucuugacu aggg aucc  ua  cg u
   uaa  -accac    c  c  c   u  -        c    -    cg  aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr26: 22970956-22971064 [+]
intergenic
Database links

Mature sequence chi-miR-146b-5p

Accession MIMAT0035972
Sequence

26 - 

ugagaacugaauuccauaggcugu

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-146b-3p

Accession MIMAT0035973
Sequence

63 - 

ugcccuagggacucaguucuggu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).