Stem-loop sequence chi-mir-146a

AccessionMI0030633 (change log)
DescriptionCapra hircus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

6 open access papers mention chi-mir-146a
(10 sentences)

Stem-loop
   -----ccuaugu      u     uu            c        g  uc 
5'             guaucc cagcu  gagaacugaauu cauagguu ug  a
               |||||| |||||  |||||||||||| |||||||| ||  g
3'             uauagg gucga  uucuugauuuga guguccag ac  u
   uccuacugucuc      -     -u            a        -  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 72031491-72031589 [+]
intergenic
Database links

Mature sequence chi-miR-146a

Accession MIMAT0035971
Sequence

21 - 

ugagaacugaauuccauagguu

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).