Stem-loop sequence chi-mir-145

AccessionMI0030631 (change log)
DescriptionCapra hircus miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

8 open access papers mention chi-mir-145
(26 sentences)

Stem-loop
   c   u  u     c  uc    u  c            uagau 
5'  acc ug ccuca gg  cagu uu ccaggaaucccu     g
    ||| || ||||| ||  |||| || ||||||||||||     c
3'  ugg ac ggagu uc  guca aa gguccuuagggg     u
   u   u  u     -  uu    u  a            uagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 60509933-60510020 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-145
chi-mir-143chr7: 60508524-60508624 [+]
chi-mir-145chr7: 60509933-60510020 [+]
Database links

Mature sequence chi-miR-145-5p

Accession MIMAT0035967
Sequence

16 - 

guccaguuuucccaggaaucccu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-145-3p

Accession MIMAT0035968
Sequence

56 - 

auuccuggaaauacuguucuu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).