Stem-loop sequence chi-mir-144

AccessionMI0030630 (change log)
DescriptionCapra hircus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

2 open access papers mention chi-mir-144
(2 sentences)

Stem-loop
   ----------------gggcccugacugggau      a         a  uug g 
5'                                 aucauc uauacugua gu   c a
                                   |||||| ||||||||| ||   | u
3'                                 uaguag auaugacau ca   g g
   ccgaggucucgacccucgugggccugcucaug      -         -  -ua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 20538924-20539019 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-144
chi-mir-144chr19: 20538924-20539019 [-]
chi-mir-451chr19: 20538775-20538845 [-]
Database links

Mature sequence chi-miR-144-5p

Accession MIMAT0035965
Sequence

11 - 

ugggauaucaucauauacugu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-144-3p

Accession MIMAT0035966
Sequence

50 - 

uacaguauagaugauguac

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).