Stem-loop sequence chi-mir-143

AccessionMI0030629 (change log)
DescriptionCapra hircus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

15 open access papers mention chi-mir-143
(44 sentences)

Stem-loop
   ------gcguccug      ag      g         g      u  -  ag 
5'               ucuccc  ccugag ugcagugcu caucuc gg uc  u
                 ||||||  |||||| ||||||||| |||||| || ||   
3'               agaggg  gggcuc augucacga guagag cu ag  u
   cgacaucuuguuga      aa      g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 60508524-60508624 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-143
chi-mir-143chr7: 60508524-60508624 [+]
chi-mir-145chr7: 60509933-60510020 [+]
Database links

Mature sequence chi-miR-143-5p

Accession MIMAT0035963
Sequence

22 - 

ggugcagugcugcaucucugg

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-143-3p

Accession MIMAT0035964
Sequence

56 - 

ugagaugaagcacuguagcucg

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).