Stem-loop sequence chi-mir-141

AccessionMI0030628 (change log)
DescriptionCapra hircus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Literature search

3 open access papers mention chi-mir-141
(4 sentences)

Stem-loop
   ga      cu   u       --    c        -   ugg  ua 
5'   ccggcu  ggg ccaucuu  ccag acaguguu gga   uc  a
     ||||||  ||| |||||||  |||| |||||||| |||   ||  u
3'   ggucgg  ccc gguagaa  gguc ugucacaa ccu   ag  g
   --      cc   -       au    -        u   cga  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr5: 104155114-104155203 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-141
chi-mir-200cchr5: 104155533-104155618 [-]
chi-mir-141chr5: 104155114-104155203 [-]
Database links

Mature sequence chi-miR-141

Accession MIMAT0035962
Sequence

58 - 

uaacacugucugguaaagaugg

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).