Stem-loop sequence chi-mir-140

AccessionMI0030627 (change log)
DescriptionCapra hircus miR-140 stem-loop
Gene family MIPF0000085; mir-140
Literature search

6 open access papers mention chi-mir-140
(11 sentences)

Stem-loop
   ---   - u uc      ucu        -  a             a       uu   uc 
5'    ugu g g  ugucuc   guguccug cc gugguuuuacccu ugguagg  acg  a
      ||| | |  ||||||   |||||||| || ||||||||||||| |||||||  |||   
3'    acg c c  acgggg   cauaggac gg caccaagauggga accaucu  ugu  u
   gcu   u u cc      --c        a  -             c       --   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr18: 40199402-40199515 [+]
intergenic
Database links

Mature sequence chi-miR-140-5p

Accession MIMAT0035960
Sequence

27 - 

cagugguuuuacccuaugguag

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-140-3p

Accession MIMAT0035961
Sequence

67 - 

accacaggguagaaccacggac

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).