Stem-loop sequence chi-mir-136

AccessionMI0030624 (change log)
DescriptionCapra hircus miR-136 stem-loop
Gene family MIPF0000099; mir-136
Literature search

2 open access papers mention chi-mir-136
(4 sentences)

Stem-loop
   ucg   -        g        c     uuu          uuc 
5'    gau gagcccuc gaggacuc auuug   ugaugaugga   u
      ||| |||||||| |||||||| |||||   ||||||||||   u
3'    cua cuugggag cuucugag uaaac   gcuacuaccu   a
   -ua   u        a        -     ucu          cgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 66967078-66967169 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-136
chi-mir-433chr21: 66962261-66962390 [+]
chi-mir-433chr21: 66964297-66964426 [+]
chi-mir-127chr21: 66965394-66965510 [+]
chi-mir-432chr21: 66966894-66966983 [+]
chi-mir-136chr21: 66967078-66967169 [+]
Database links

Mature sequence chi-miR-136-5p

Accession MIMAT0035955
Sequence

20 - 

acuccauuuguuuugaugaugg

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-136-3p

Accession MIMAT0035956
Sequence

55 - 

aucaucgucucaaaugagucu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).