Stem-loop sequence chi-mir-135a

AccessionMI0030622 (change log)
DescriptionCapra hircus miR-135a stem-loop
Gene family MIPF0000028; mir-135
Literature search

3 open access papers mention chi-mir-135a
(4 sentences)

Stem-loop
   a g         u u          uu            uucua 
5'  g ccucgcugu c cuauggcuuu  auuccuauguga     c
    | ||||||||| | ||||||||||  ||||||||||||     u
3'  c ggggcggca g ggugccgagg  uagggauauacu     g
   a g         c c          -u            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr22: 50096622-50096711 [+]
intergenic
Database links

Mature sequence chi-miR-135a

Accession MIMAT0035952
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).