Stem-loop sequence chi-mir-134

AccessionMI0030621 (change log)
DescriptionCapra hircus miR-134 stem-loop
Gene family MIPF0000112; mir-134
Literature search

1 open access papers mention chi-mir-134
(1 sentences)

Stem-loop
   ---u     cagcacc   c     gu     -u   uga        gca   a 
5'     ggugu       guu agggu  gugac  ggu   ccagaggg   agc c
       |||||       ||| |||||  |||||  |||   ||||||||   ||| u
3'     ccacg       cga uccca  cacug  ccg   ggucuccc   uug c
   ccgu     ccaacca   c     ac     cu   ucg        -ac   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67131102-67131209 [+]
intergenic
chr21: 67132776-67132883 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-134
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
Database links

Mature sequence chi-miR-134

Accession MIMAT0035951
Sequence

24 - 

ugugacugguugaccagagggg

 - 45

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).