Stem-loop sequence chi-mir-1343

AccessionMI0030620 (change log)
DescriptionCapra hircus miR-1343 stem-loop
Gene family MIPF0001206; mir-1343
Literature search

2 open access papers mention chi-mir-1343
(2 sentences)

Stem-loop
   ugcug   u   u  u    a    c       -c     ucu 
5'      gcu cgg gc gggg gcgg ccccggg  gggcc   g
        ||| ||| || |||| |||| |||||||  |||||    
3'      cgg gcc cg ucuc cgcc ggggucc  cccgg   c
   -----   -   u  c    a    c       uc     ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr15: 68128730-68128810 [+]
intergenic
Database links

Mature sequence chi-miR-1343

Accession MIMAT0035950
Sequence

53 - 

cuccuggggcccgcacucucgc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).