Stem-loop sequence chi-mir-133b

AccessionMI0030619 (change log)
DescriptionCapra hircus miR-133b stem-loop
Gene family MIPF0000029; mir-133
Literature search

7 open access papers mention chi-mir-133b
(18 sentences)

Stem-loop
   ------------------    --       c        ca  c  a      u  g      
5'                   ugcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
                     ||||  ||||||| ||||||||  || || |||||| || |||| c
3'                   acgg  gggacga aucgacca  uu cc ugguuu gg agagu 
   agagguuccugacccgaa    uc       c        ac  c  c      -  -      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr23: 25419918-25420022 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-133b
chi-mir-206chr23: 25415849-25415934 [+]
chi-mir-133bchr23: 25419918-25420022 [+]
Database links

Mature sequence chi-miR-133b

Accession MIMAT0035949
Sequence

52 - 

uuugguccccuucaaccagcu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).