Stem-loop sequence chi-mir-133a

AccessionMI0030618 (change log)
DescriptionCapra hircus miR-133a stem-loop
Gene family MIPF0000029; mir-133
Literature search

8 open access papers mention chi-mir-133a
(32 sentences)

Stem-loop
   cgggaccg     uuu    a       aa  u  a        aacug 
5'         aaugc   gcua agcuggu  aa gg accaaauc     u
           |||||   |||| |||||||  || || ||||||||      
3'         uuacg   cgau ucgacca  uu cc ugguuuag     u
   -----uag     ugu    g       ac  c  c        guagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr13: 55645237-55645331 [-]
intergenic
Database links

Mature sequence chi-miR-133a-5p

Accession MIMAT0035947
Sequence

22 - 

agcugguaaaauggaaccaaau

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-133a-3p

Accession MIMAT0035948
Sequence

59 - 

uuugguccccuucaaccagcugu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).