Stem-loop sequence chi-mir-130b

AccessionMI0030617 (change log)
DescriptionCapra hircus miR-130b stem-loop
Gene family MIPF0000034; mir-130
Literature search

2 open access papers mention chi-mir-130b
(84 sentences)

Stem-loop
         c    ca       cc         a  g   gc 
5' ggccug cuga  cucuuuc  uguugcacu cu ugc  c
   |||||| ||||  |||||||  ||||||||| || |||  c
3' ccgggc ggcu  gggaaag  guaacguga ga acg  c
         u    ac       ua         c  -   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
AJPT02103319.1: 195466-195547 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-130b
chi-mir-301bAJPT02103319.1: 195772-195868 [-]
chi-mir-130bAJPT02103319.1: 195466-195547 [-]
Database links

Mature sequence chi-miR-130b-5p

Accession MIMAT0035945
Sequence

13 - 

acucuuucccuguugcacuacu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-130b-3p

Accession MIMAT0035946
Sequence

51 - 

cagugcaaugaugaaagggcau

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).