Stem-loop sequence chi-mir-130a

AccessionMI0030616 (change log)
DescriptionCapra hircus miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

5 open access papers mention chi-mir-130a
(5 sentences)

Stem-loop
   u      -      a        c      ug  a   ucu  g 
5'  gcugcg ggccgg gcucuuuu acauug  cu cug   gc c
    |||||| |||||| |||||||| ||||||  || |||   ||  
3'  cgacgc ccgguu cgggaaaa uguaac  ga gau   ug c
   g      g      a        u      gu  c   cac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr15: 82844823-82844911 [+]
intergenic
AJPT02088135.1: 1229-1317 [-]
intergenic
Database links

Mature sequence chi-miR-130a-5p

Accession MIMAT0035943
Sequence

15 - 

gcucuuuucacauugugcuacu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-130a-3p

Accession MIMAT0035944
Sequence

55 - 

cagugcaauguuaaaagggca

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).