Stem-loop sequence chi-mir-1307

AccessionMI0030615 (change log)
DescriptionCapra hircus miR-1307 stem-loop
Gene family MIPF0000558; mir-1307
Literature search

2 open access papers mention chi-mir-1307
(3 sentences)

Stem-loop
   --------------ca  -    g   g   a  cacu      -gc      aucu       -a  u  a   gc   ucuaug 
5'                 uc aaga ucg cug gu    gccacu   cuacca    cgaccgg  cc cg ccg  ucg      u
                   || |||| ||| ||| ||    ||||||   ||||||    |||||||  || || |||  |||       
3'                 ag uuuu agc gac ua    uggugg   gauggu    gcuggcu  gg gc ggc  agc      u
   cagugguuucguugug  c    g   a   a  ---c      aua      ----       gc  u  -   uc   uaaccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr26: 23857628-23857776 [-]
intergenic
Database links

Mature sequence chi-miR-1307-5p

Accession MIMAT0035941
Sequence

41 - 

ucgaccggaccucgacc

 - 57

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-1307-3p

Accession MIMAT0035942
Sequence

80 - 

acucggcguggcgucggucgugg

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).