Stem-loop sequence chi-mir-127

AccessionMI0030608 (change log)
DescriptionCapra hircus miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

5 open access papers mention chi-mir-127
(19 sentences)

Stem-loop
   ---------cuc  -uu   --uc   guc   a   u   g         g  c      --  a 
5'             gc   uga    acu   ucc gcc gcu aagcucaga gg ucugau  uc g
               ||   |||    |||   ||| ||| ||| ||||||||| || ||||||  || a
3'             cg   acu    uga   agg ugg cgg uucgagucu cc aggcua  ag a
   uugggcuuccuu  ucu   ccuc   ---   c   u   -         g  u      cu  a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 66965394-66965510 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-127
chi-mir-433chr21: 66962261-66962390 [+]
chi-mir-433chr21: 66964297-66964426 [+]
chi-mir-127chr21: 66965394-66965510 [+]
chi-mir-432chr21: 66966894-66966983 [+]
chi-mir-136chr21: 66967078-66967169 [+]
Database links

Mature sequence chi-miR-127-5p

Accession MIMAT0035929
Sequence

30 - 

gaagcucagagggcucugauuc

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-127-3p

Accession MIMAT0035930
Sequence

62 - 

ucggauccgucugagcuugg

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).