Stem-loop sequence chi-mir-126

AccessionMI0030607 (change log)
DescriptionCapra hircus miR-126 stem-loop
Gene family MIPF0000115; mir-126
Literature search

5 open access papers mention chi-mir-126
(11 sentences)

Stem-loop
   g   g      - a           u       c cug   c 
5'  cug ugacgg g cauuauuacuu ugguacg g   uga a
    ||| |||||| | ||||||||||| ||||||| |   |||  
3'  gac acugcc c guaauaaugag gccaugc c   acu c
   -   g      g -           u       u -aa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr11: 107845630-107845711 [+]
intergenic
Database links

Mature sequence chi-miR-126-5p

Accession MIMAT0035927
Sequence

14 - 

cauuauuacuuuugguacgcgc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-126-3p

Accession MIMAT0035928
Sequence

51 - 

ucguaccgugaguaauaaugc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).