Stem-loop sequence chi-mir-125b

AccessionMI0030606 (change log)
DescriptionCapra hircus miR-125b stem-loop
Gene family MIPF0000033; mir-10
Literature search

10 open access papers mention chi-mir-125b
(24 sentences)

Stem-loop
   ga   uu     uc  ug   c   a        -gg   u 
5'   cuu  ccuag  cc  aga ccu acuuguga   uau u
     |||  |||||  ||  ||| ||| ||||||||   |||  
3'   gag  ggauc  gg  ucu gga ugaacacu   aug u
   gg   gc     ca  gu   c   c        aca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr1: 20759329-20759411 [-]
intergenic
Database links

Mature sequence chi-miR-125b-5p

Accession MIMAT0035925
Sequence

13 - 

ucccugagacccuaacuugu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-125b-3p

Accession MIMAT0035926
Sequence

52 - 

acaagucaggcucuugggacc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).