Stem-loop sequence chi-mir-125a

AccessionMI0030605 (change log)
DescriptionCapra hircus miR-125a stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention chi-mir-125a
(13 sentences)

Stem-loop
   ------------c uc  ug   c    ua        ----  a 
5'              g  cc  aga ccuu  accuguga    gg c
                |  ||  ||| ||||  ||||||||    ||  
3'              c  gg  ucu ggag  uggacacu    cc g
   ccggccugcgguc ga  gu   u    --        ggga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr18: 62076263-62076336 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-125a
chi-mir-99bchr18: 62075592-62075661 [+]
chi-let-7echr18: 62075747-62075855 [+]
chi-mir-125achr18: 62076263-62076336 [+]
Database links

Mature sequence chi-miR-125a-5p

Accession MIMAT0035923
Sequence

3 - 

ucccugagacccuuuaaccugu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-125a-3p

Accession MIMAT0035924
Sequence

41 - 

acaggugagguucuugggagc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).