Stem-loop sequence chi-mir-124a

AccessionMI0030604 (change log)
DescriptionCapra hircus miR-124a stem-loop
Gene family MIPF0000021; mir-124
Literature search

3 open access papers mention chi-mir-124a
(4 sentences)

Stem-loop
   ----------aucaagaucagac     c  cc        a   ga        uaau 
5'                        ucugc cu  guguucac gcg  ccuugauu    g
                          ||||| ||  |||||||| |||  ||||||||    u
3'                        aggcg ga  cguaagug cgc  ggaauuaa    c
   aaguucacgucggcgggcauccg     a  ac        g   ac        caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr14: 40474234-40474344 [+]
intergenic
Database links

Mature sequence chi-miR-124a

Accession MIMAT0035922
Sequence

60 - 

uaaggcacgcggugaaugcc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).