Stem-loop sequence chi-mir-1249

AccessionMI0030603 (change log)
DescriptionCapra hircus miR-1249 stem-loop
Gene family MIPF0000667; mir-1249
Literature search

1 open access papers mention chi-mir-1249
(1 sentences)

Stem-loop
   -------uccucagauucuu      a    -        a  a  u    cac     cuc 
5'                     guuugc uggg gaggaggg gg ga gggc   guucc   u
                       |||||| |||| |||||||| || || ||||   |||||    
3'                     caagcg aucc cuucuucc cc cu cccg   caagg   g
   cagaacuuccugcucauccu      -    a        c  c  u    ---     ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
AJPT02057647.1: 77-190 [+]
intergenic
Database links

Mature sequence chi-miR-1249

Accession MIMAT0035921
Sequence

63 - 

acgcccuucccccccuucuuca

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).