Stem-loop sequence chi-mir-122

AccessionMI0030600 (change log)
DescriptionCapra hircus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

3 open access papers mention chi-mir-122
(7 sentences)

Stem-loop
   ----------c        -      gg       c           --u  c 
5'            cuuagcag agcugu  aguguga aaugguguuug   gu c
              |||||||| ||||||  ||||||| |||||||||||   ||  
3'            ggauuguc ucgaua  ucacacu uuaccgcaaac   ca a
   cccuuccuaac        a      aa       a           uau  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr24: 60739784-60739878 [+]
intergenic
Database links

Mature sequence chi-miR-122

Accession MIMAT0035918
Sequence

15 - 

uggagugugacaaugguguuug

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).