Stem-loop sequence chi-mir-1197

AccessionMI0030599 (change log)
DescriptionCapra hircus miR-1197 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   -gaggcgaggucggcaucccuucc       -u     cgc   u       gug g    - uuu 
5'                         ugguauu  gaaga   ggu gaccaug   u uacg c   a
                           |||||||  |||||   ||| |||||||   | |||| |   u
3'                         acuauag  cuucu   uca cugguac   g augc g   u
   ccuuccagaagguuccgcuucuac       cu     ---   u       aca g    a uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67103896-67104024 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-1197
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
Database links

Mature sequence chi-miR-1197-3p

Accession MIMAT0035917
Sequence

74 - 

uaggacacauggucuacuucu

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).