Stem-loop sequence chi-mir-1185

AccessionMI0030598 (change log)
DescriptionCapra hircus miR-1185 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   -a   -g   --------        u    -     ga a              a  uua 
5'   gcu  ccc        uuugguac ugaa gagag  u cccuuuguauguuc cu   u
     |||  |||        |||||||| |||| |||||  | |||||||||||||| ||    
3'   cgg  ggg        aaacuaug guuu uucuc  a gggagacauauaag gg   u
   cg   aa   ucagucuc        c    a     ag -              c  caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67119939-67120050 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-1185
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
Database links

Mature sequence chi-miR-1185-5p

Accession MIMAT0035915
Sequence

23 - 

agaggauacccuuuguaugu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-1185-3p

Accession MIMAT0035916
Sequence

61 - 

auauacagagggagacucuuau

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).