Stem-loop sequence chi-mir-10b

AccessionMI0030597 (change log)
DescriptionCapra hircus miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

8 open access papers mention chi-mir-10b
(29 sentences)

Stem-loop
   ------caguaa     u        a    g     c          u g   c 
5'             cguug cuauauau cccu uagaa cgaauuugug g uau c
               ||||| |||||||| |||| ||||| |||||||||| | |||  
3'             guagc gguauaua gggg aucuu gcuuagacac u aug u
   cacuucaaaaac     u        a    -     a          - g   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr2: 21871351-21871454 [-]
intergenic
Database links

Mature sequence chi-miR-10b-5p

Accession MIMAT0035913
Sequence

20 - 

uacccuguagaaccgaauuugu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-10b-3p

Accession MIMAT0035914
Sequence

59 - 

acagauucgauucuaggggaau

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).