Stem-loop sequence chi-mir-107

AccessionMI0030595 (change log)
DescriptionCapra hircus miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

4 open access papers mention chi-mir-107
(7 sentences)

Stem-loop
   -      c      --c    u  u           c   u   a 
5'  uucucu ugcuuu   agcu cu uacaguguugc uug ggc u
    |||||| ||||||   |||| || ||||||||||| ||| ||| g
3'  gagaga acgaaa   ucgg ga auguuacgacg aac uug g
   c      c      cua    -  c           -   -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr26: 11322796-11322882 [-]
intergenic
Database links

Mature sequence chi-miR-107-3p

Accession MIMAT0035910
Sequence

52 - 

agcagcauuguacagggcuau

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).