Stem-loop sequence chi-mir-106a

AccessionMI0030593 (change log)
DescriptionCapra hircus miR-106a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
     u   cc      -        a  g     g   c  u 
5' cc ugg  auguaa aagugcuu ca ugcag uag uu u
   || |||  |||||| |||||||| || ||||| ||| || u
3' gg acc  uacauu uucacgaa gu acguc auc ag g
     u   au      c        c  a     -   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 40075491-40075571 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-106a
chi-mir-106achrX: 40075491-40075571 [-]
chi-mir-18bchrX: 40075324-40075417 [-]
chi-mir-20bchrX: 40075091-40075165 [-]
chi-mir-92bchrX: 40074814-40074900 [-]
chi-mir-363chrX: 40074650-40074760 [-]
Database links

Mature sequence chi-miR-106a-5p

Accession MIMAT0035906
Sequence

13 - 

aaaagugcuuacagugcagguagc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-106a-3p

Accession MIMAT0035907
Sequence

48 - 

uacugcaaugcaagcacuucuu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).