Stem-loop sequence chi-mir-103

AccessionMI0030590 (change log)
DescriptionCapra hircus miR-103 stem-loop
Gene family MIPF0000024; mir-103
Literature search

9 open access papers mention chi-mir-103
(134 sentences)

Stem-loop
   g    u  g      --   u  u           ----    ua 
5'  ucuu gu cuuuca  gcu cu uacagugcugc    cuug  g
    |||| || ||||||  ||| || |||||||||||    ||||  c
3'  agaa ca gaaagu  cgg ga auguuacgacg    ggac  a
   a    u  a      au   -  c           aacu    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr13: 51964308-51964393 [-]
intergenic
Database links

Mature sequence chi-miR-103-5p

Accession MIMAT0035901
Sequence

15 - 

agcuucuuuacagugcugccuuguagcauu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-103-3p

Accession MIMAT0035902
Sequence

52 - 

agcagcauuguacagggcuauga

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).