Stem-loop sequence chi-mir-101

AccessionMI0030589 (change log)
DescriptionCapra hircus miR-101 stem-loop
Gene family MIPF0000046; mir-101
Literature search

2 open access papers mention chi-mir-101
(4 sentences)

Stem-loop
   a       cuggc                  a    gucca 
5'  ggcugcc     ucaguuaucacagugcug ugcu     u
    |||||||     |||||||||||||||||| ||||      
3'  ccgacgg     agucaauagugucaugac augg     u
   a       uagga                  -    aaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr3: 81377563-81377645 [+]
intergenic
Database links

Mature sequence chi-miR-101-5p

Accession MIMAT0035899
Sequence

14 - 

ucaguuaucacagugcugaugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-101-3p

Accession MIMAT0035900
Sequence

51 - 

uacaguacugugauaacuga

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).