Stem-loop sequence chi-mir-100

AccessionMI0030588 (change log)
DescriptionCapra hircus miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention chi-mir-100
(2 sentences)

Stem-loop
   ag   ug u c    a   cg    uc   a      -  ga 
5'   gcc  u g caca acc  uaga  cga cuugug gu  u
     |||  | | |||| |||  ||||  ||| |||||| ||   
3'   cgg  g c gugu ugg  aucu  guu gaacac cg  a
   --   gu u u    a   au    gu   c      a  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr15: 35916181-35916263 [-]
intergenic
Database links

Mature sequence chi-miR-100-5p

Accession MIMAT0035897
Sequence

16 - 

aacccguagauccgaacuugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-100-3p

Accession MIMAT0035898
Sequence

51 - 

caagcuugugucuauagguau

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).