Stem-loop sequence chi-mir-1

AccessionMI0030587 (change log)
DescriptionCapra hircus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

9 open access papers mention chi-mir-1
(48 sentences)

Stem-loop
   -----ua    -    gg a                gc     ---   a 
5'        ccug cuug  a acauacuucuuuaugu  ccaua   ugg c
          |||| ||||  | ||||||||||||||||  |||||   ||| c
3'        gggc ggac  u uguaugaagaaaugua  gguau   auc u
   cucucaa    u    uu a                -a     cga   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr13: 55656779-55656871 [-]
intergenic
chr13: 55661799-55661891 [-]
intergenic
chr13: 55663345-55663437 [-]
intergenic
Database links

Mature sequence chi-miR-1

Accession MIMAT0035896
Sequence

54 - 

uggaauguaaagaaguauguau

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).