Stem-loop sequence chi-let-7i

AccessionMI0030586 (change log)
DescriptionCapra hircus let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

15 open access papers mention chi-let-7i
(36 sentences)

Stem-loop
   cccga     ug  c     u                 u   --------  u     ugu 
5'      cacca  gc cuggc gagguaguaguuugugc guu        gg cgggu   g
        |||||  || ||||| ||||||||||||||||| |||        || |||||   a
3'      guggu  cg gaucg uuccgucaucgaacgcg caa        uc gcccg   c
   -----     --  u     -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr5: 52010869-52010976 [-]
intergenic
Database links

Mature sequence chi-let-7i-5p

Accession MIMAT0035894
Sequence

21 - 

ugagguaguaguuugugcuguu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-let-7i-3p

Accession MIMAT0035895
Sequence

77 - 

cugcgcaagcuacugccuugcu

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).