Stem-loop sequence chi-let-7f

AccessionMI0030584 (change log)
DescriptionCapra hircus let-7f stem-loop
Gene family MIPF0000002; let-7
Literature search

18 open access papers mention chi-let-7f
(55 sentences)

Stem-loop
   aaaaga       a    a ug                      ---------       u 
5'       uugcucu ucag g  agguaguagauuguauaguugu         gggguag g
         ||||||| |||| |  ||||||||||||||||||||||         ||||||| a
3'       gaugagg aguc c  uccguuaucuaacauaucaaua         ucccauu u
   ----ca       -    - cu                      gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 86751159-86751268 [+]
intergenic
Clustered miRNAs
< 10kb from chi-let-7f
chi-let-7fchr8: 86751159-86751268 [+]
chi-let-7dchr8: 86753372-86753476 [+]
Database links

Mature sequence chi-let-7f-5p

Accession MIMAT0035890
Sequence

21 - 

ugagguaguagauuguauaguu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-let-7f-3p

Accession MIMAT0035891
Sequence

77 - 

cuauacaaucuauugccuuccc

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).