Stem-loop sequence chi-let-7e

AccessionMI0030583 (change log)
DescriptionCapra hircus let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

13 open access papers mention chi-let-7e
(34 sentences)

Stem-loop
   -a  -   --c    cc  c   cu   g                u  ----gga  a 
5'   cc ugc   gcgc  cc ggg  gag uaggagguuguauagu ga       gg c
     || |||   ||||  || |||  ||| |||||||||||||||| ||       ||  
3'   gg acg   cgcg  gg ccc  uuc auccuccggcauauca cu       cc a
   ag  c   ucc    uc  a   cu   g                -  agaggaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr18: 62075747-62075855 [+]
intergenic
Clustered miRNAs
< 10kb from chi-let-7e
chi-mir-99bchr18: 62075592-62075661 [+]
chi-let-7echr18: 62075747-62075855 [+]
chi-mir-125achr18: 62076263-62076336 [+]
Database links

Mature sequence chi-let-7e-5p

Accession MIMAT0035888
Sequence

21 - 

ugagguaggagguuguauaguu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-let-7e-3p

Accession MIMAT0035889
Sequence

66 - 

cuauacggccuccuagcuuucc

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).