Stem-loop sequence chi-let-7d

AccessionMI0030582 (change log)
DescriptionCapra hircus let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

13 open access papers mention chi-let-7d
(35 sentences)

Stem-loop
   --      uu       a              c      uuagggcagggauu 
5'   aauggg  ccuagga gagguaguagguug auaguu              u
     ||||||  ||||||| |||||||||||||| ||||||               
3'   uuauuc  ggauucu uuccgucguccagc uaucaa              u
   ua      cg       -              a      uggaggaacacccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 86753372-86753476 [+]
intergenic
Clustered miRNAs
< 10kb from chi-let-7d
chi-let-7fchr8: 86751159-86751268 [+]
chi-let-7dchr8: 86753372-86753476 [+]
Database links

Mature sequence chi-let-7d-5p

Accession MIMAT0035886
Sequence

16 - 

agagguaguagguugcauaguu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-let-7d-3p

Accession MIMAT0035887
Sequence

70 - 

cuauacgaccugcugccuuuc

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).