Stem-loop sequence bra-MIR161

AccessionMI0030578 (change log)
DescriptionBrassica rapa miR161 stem-loop
Gene family MIPF0000455; MIR161
Literature search

3 open access papers mention bra-MIR161
(7 sentences)

Stem-loop
   uuuau    uc          c                  -cauuu       agcuuucgcucuc 
5'      ugcu  gaucaaugca ugaaagugacuacaucag      guuuuua             a
        ||||  |||||||||| ||||||||||||||||||      |||||||             u
3'      acga  cuaguugcgu acuuucacugauguaguc      uaaaagu             c
   ---gu    ua          a                  uccgau       agaaguaguauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA5: 12400028-12400158 [-]
intergenic
Database links

Mature sequence bra-miR161-5p

Accession MIMAT0035878
Sequence

14 - 

ucaaugcacugaaagugacua

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR161-3p

Accession MIMAT0035879
Sequence

103 - 

gucacuuucaaugcguugauc

 - 123

Get sequence
Evidence experimental; Illumina [1]

References

1