Stem-loop sequence bra-MIR172d

AccessionMI0030577 (change log)
DescriptionBrassica rapa miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

14 open access papers mention bra-MIR172d
(50 sentences)

Stem-loop
          a                     a      a  u  uuuu 
5' uaguugc gaugcagcaucauuaagauuc caagag ug gg    c
   ||||||| ||||||||||||||||||||| |||||| || ||    u
3' aucaacg cuacgucguaguaguucuaag guucuc gc cu    u
          a                     g      c  u  uuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 4762900-4762994 [-]
intergenic
Database links

Mature sequence bra-miR172d-5p

Accession MIMAT0035876
Sequence

12 - 

gcagcaucauuaagauucaca

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR172d-3p

Accession MIMAT0035877
Sequence

66 - 

ggaaucuugaugaugcugcau

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1