Stem-loop sequence bra-MIR2111

AccessionMI0030576 (change log)
DescriptionBrassica rapa miR2111 stem-loop
Gene family MIPF0000754; MIR2111
Literature search

4 open access papers mention bra-MIR2111
(6 sentences)

Stem-loop
   -uauug       cc                          -   ----   g          a      g 
5'       gugagga  ggguaaucugcauccugggguuuaag guu    uaa uacacgcaaa auaugc u
         |||||||  |||||||||||||||||||||||||| |||    ||| |||||||||| ||||||  
3'       cauuccu  uccauuaggcguaggacuccagauuu cga    auu guguguguuu uauacg a
   gcauaa       uc                          u   uaug   -          a      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 27648068-27648204 [-]
intergenic
Database links

Mature sequence bra-miR2111-5p

Accession MIMAT0035874
Sequence

18 - 

uaaucugcauccugggguuua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR2111-3p

Accession MIMAT0035875
Sequence

101 - 

gaccucaggaugcggauuacc

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1