Stem-loop sequence bra-MIR172c

AccessionMI0030575 (change log)
DescriptionBrassica rapa miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

14 open access papers mention bra-MIR172c
(50 sentences)

Stem-loop
   uucagacuuugaagcaguugca       -u    ua     u              ag      uauuccuu         uc 
5'                       gucauuu  uugc  uugca caucaucaagauuc  aaauca        gauggguuc  c
                         |||||||  ||||  ||||| ||||||||||||||  ||||||        |||||||||   
3'                       cgguaaa  agcg  gacgu guaguaguucuaag  uuuggu        cuguccgag  u
   --------------uauuuuuu       uu    gc     c              ag      ---uuuuu         cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 27738162-27738313 [+]
intergenic
Database links

Mature sequence bra-miR172c-5p

Accession MIMAT0035872
Sequence

39 - 

gcaucaucaucaagauucaga

 - 59

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR172c-3p

Accession MIMAT0035873
Sequence

109 - 

agaaucuugaugaugcugcag

 - 129

Get sequence
Evidence experimental; Illumina [1]

References

1