Stem-loop sequence bra-MIR164e

AccessionMI0030574 (change log)
DescriptionBrassica rapa miR164e stem-loop
Gene family MIPF0000045; MIR164
Literature search

10 open access papers mention bra-MIR164e
(24 sentences)

Stem-loop
   gua      aac   c         a  ca             c  --aa     u a 
5'    ggugag   cuc auguuggag ag  gggcacgugcaaa ca    aaaca g a
      ||||||   ||| ||||||||| ||  ||||||||||||| ||    ||||| |  
3'    ccacuc   gag uacaaccuc uc  cucgugcacguuu gu    uuugu c a
   uua      cuc   -         c  cc             c  auac     - u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 25366674-25366787 [-]
intergenic
Database links

Mature sequence bra-miR164e-5p

Accession MIMAT0035870
Sequence

21 - 

uggagaagcagggcacgugcaa

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR164e-3p

Accession MIMAT0035871
Sequence

77 - 

cacgugcuccccuccuccaac

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1