Stem-loop sequence bra-MIR164c

AccessionMI0030573 (change log)
DescriptionBrassica rapa miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

10 open access papers mention bra-MIR164c
(24 sentences)

Stem-loop
   aacacu  c     a  c              cua    ga   cug 
5'       ug uggag ag agggcacgugcgaa   auga  gau   u
         || ||||| || ||||||||||||||   ||||  |||    
3'       ac accuc uc ucuugugcacguuu   uacu  uug   g
   -----c  a     a  a              uua    ag   uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 2025610-2025700 [-]
intergenic
Database links

Mature sequence bra-miR164c-5p

Accession MIMAT0035868
Sequence

10 - 

uggagaagcagggcacgugcg

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR164c-3p

Accession MIMAT0035869
Sequence

69 - 

cacguguucuacuacuccaac

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1