Stem-loop sequence bra-MIR164d

AccessionMI0030572 (change log)
DescriptionBrassica rapa miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

10 open access papers mention bra-MIR164d
(24 sentences)

Stem-loop
   --------guau   u  c     a  c              caaauga      g   ua 
5'             cac ug uggag ag agggcacgugcgaa       guuuga cag  c
               ||| || ||||| || ||||||||||||||       |||||| |||   
3'             gug ac accuc uc ucuugugcacgcuu       uaaacu guu  a
   cuuccccucuau   c  a     a  a              ------a      a   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 18241365-18241474 [-]
intergenic
Database links

Mature sequence bra-miR164d-5p

Accession MIMAT0035866
Sequence

12 - 

uggagaagcagggcacgugcg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR164d-3p

Accession MIMAT0035867
Sequence

73 - 

cacguguucuacuacuccaac

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1