Stem-loop sequence bra-MIR164b

AccessionMI0030571 (change log)
DescriptionBrassica rapa miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

10 open access papers mention bra-MIR164b
(24 sentences)

Stem-loop
   ------   u     u  c     a  c              ca    a       cgg 
5'       gag uacac ug uggag ag agggcacgugcgaa  aaug gaucgau   u
         ||| ||||| || ||||| || ||||||||||||||  |||| |||||||    
3'       cuc gugug ac accuc uc ucuugugcacgcuu  uuau cuaguug   a
   cucccc   c     c  a     a  a              --    a       uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA2: 24491315-24491426 [+]
intergenic
Database links

Mature sequence bra-miR164b-5p

Accession MIMAT0035864
Sequence

14 - 

uggagaagcagggcacgugcg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR164b-3p

Accession MIMAT0035865
Sequence

75 - 

cacguguucuacuacuccaac

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1