Stem-loop sequence bra-MIR6032

AccessionMI0030570 (change log)
DescriptionBrassica rapa miR6032 stem-loop
Gene family MIPF0002003; MIR6032
Literature search

1 open access papers mention bra-MIR6032
(1 sentences)

Stem-loop
   u     u    u          -    a        g   --  ug   ga 
5'  uauuu guuu aacauggagc auca cagaucuc gag  ca  uaa  u
    ||||| |||| |||||||||| |||| |||||||| |||  ||  |||   
3'  auaaa caaa uuguaccuug uggu gucuaggg cuc  gu  guu  c
   a     u    -          c    c        g   cu  uu   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA2: 7680879-7680978 [-]
intergenic
Database links

Mature sequence bra-miR6032-5p

Accession MIMAT0035862
Sequence

13 - 

aacauggagcaucaacagauc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR6032-3p

Accession MIMAT0035863
Sequence

70 - 

ucugcuggucguuccauguuaa

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1