Stem-loop sequence bra-MIR860

AccessionMI0030569 (change log)
DescriptionBrassica rapa miR860 stem-loop
Gene family MIPF0001176; MIR860
Literature search

1 open access papers mention bra-MIR860
(1 sentences)

Stem-loop
   -        u                   c       g    --ag    c      u 
5'  uggucaag guaauguauguaguccaau uauugaa uacu    caca caucuc a
    |||||||| ||||||||||||||||||| ||||||| ||||    |||| ||||||  
3'  acuaguuu cauuauauacaucagguua auaacuu auga    gugu guagag g
   a        u                   c       g    guug    a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 17845504-17845618 [+]
intergenic
Database links

Mature sequence bra-miR860-5p

Accession MIMAT0035860
Sequence

17 - 

auguaguccaaucuauugaag

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR860-3p

Accession MIMAT0035861
Sequence

80 - 

ucaauacauuggacuacauau

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1