Stem-loop sequence bra-MIR403

AccessionMI0030568 (change log)
DescriptionBrassica rapa miR403 stem-loop
Gene family MIPF0000290; MIR403
Literature search

2 open access papers mention bra-MIR403
(2 sentences)

Stem-loop
   agag     u  u     au    u                  uau  ucau    u 
5'     aagag ca auuac  guuu gugcgugaaucuaauucg   gc    guag a
       ||||| || |||||  |||| ||||||||||||||||||   ||    |||| a
3'     uuuuc gu uaaug  caaa cacgcacuuagauuaggu   ug    uauc u
   ----     u  c     cu    -                  ugu  -uuc    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA5: 266420-266530 [-]
intergenic
Database links

Mature sequence bra-miR403-5p

Accession MIMAT0035858
Sequence

20 - 

uguuuugugcgugaaucuaauu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR403-3p

Accession MIMAT0035859
Sequence

78 - 

uuagauucacgcacaaacucg

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1